Working with Files and Directories

Overview

Teaching: 30 min
Exercises: 15 min

Questions

How can I view and search file contents?

How can I create, copy and delete files and directories?

How can I control who has permission to modify a file?

How can I repeat recently used commands?

Objectives

View, search within, copy, move, and rename files. Create new directories.

Use wildcards (*) to perform operations on multiple files.

Make a file read only

Use the history command to view and repeat recently used commands.

Working with Files

Wildcards

Now that we know how to navigate around our directory structure, let’s start working with our sequencing files. We did a sequencing experiment and have four result files, which are stored in our untrimmed_fastq directory.

Navigate to your untrimmed_fastq directory.

$ cd ~/dc_workshop/data/untrimmed_fastq

We are interested in looking at the FASTQ files in this directory. We can list all files with the .fastq extension using the command:

$ ls *.fastq

JC1A_R1.fastq JC1A_R2.fastq JP4D_R1.fastq JP4D_R2.fastq

The * character is a special type of character called a wildcard, which can be used to represent any number of any type of character. Thus, *.fastq matches every file that ends with .fastq.

This command:

$ ls *R1.fastq

JC1A_R1.fastq JP4D_R1.fastq

lists only the file that ends with R1.fastq.

Command History

If you want to repeat a command that you’ve run recently, you can access previous commands using the up arrow on your keyboard to go back to the most recent command. Likewise, the down arrow takes you forward in the command history.

A few more useful shortcuts:

Ctrl+C will cancel the command you are writing, and give you a fresh prompt.
Ctrl+R will do a reverse-search through your command history. This is very useful.
Ctrl+L or the clear command will clear your screen.

You can also review your recent commands with the history command, by entering:

$ history

to see a numbered list of recent commands. You can reuse one of these commands directly by referring to the number of that command.

For example, if your history looked like this:

ls *
ls /usr/bin/*.sh
ls *R1*fastq

then you could repeat command #260 by entering:

$ !260

Type ! (exclamation point) and then the number of the command from your history. You will be glad you learned this when you need to re-run very complicated commands.

Examining Files

We now know how to switch directories, run programs, and look at the contents of directories, but how do we look at the contents of files?

One way to examine a file is to print out on the screen all of the contents using the program cat.

$ cat JC1A_R2.fastq

cat is a terrific program, but, as you just saw if your ran the command, when the file is really big (as the files we have), it can be annoying to use. You can always use Ctrl+C to stop the command.

The program, less, is useful for this case. less opens the file as read only, and lets you navigate through it. The navigation commands are identical to the man program.

Enter the following command:

$ less JC1A_R2.fastq

Some navigation commands in less

key	action
`Space`	to go forward
`b`	to go backward
`g`	to go to the beginning
`G`	to go to the end
`q`	to quit

less also gives you a way of searching through files. Use the “/” key to begin a search. Enter the word you would like to search for and press enter. The screen will jump to the next location where that word is found.

Shortcut: If you hit “/” then “enter”, less will repeat the previous search. less searches from the current location and works its way forward. Note, if you are at the end of the file and search for the sequence “CAA”, less will not find it. You either need to go to the beginning of the file (by typing g) and search again using / or you can use ? to search backwards in the same way you used / previously.

For instance, let’s search forward for the sequence TTTTT in our file. You can see that we go right to that sequence, what it looks like, and where it is in the file. If you continue to type / and hit return, you will move forward to the next instance of this sequence motif. If you instead type ? and hit return, you will search backwards and move up the file to previous examples of this motif.

Remember, the man program actually uses less internally and therefore uses the same commands, so you can search documentation using “/” as well!

There’s another way that we can look at files, and in this case, just look at part of them. This can be particularly useful if we just want to see the beginning or end of the file, or see how it’s formatted.

The commands are head and tail and they let you look at the beginning and end of a file, respectively.

$ head JC1A_R2.fastq

@MISEQ-LAB244-W7:91:000000000-A5C7L:1:1101:13417:1998 2:N:0:TCGNAG
CGCGATCAGCAGCGGCCCGGAACCGGTCAGCCGCGCCNTGGGGTTCAGCACCGGCNNGGCGAAGGCCGCGATCGCGGCGGCGGCGATCAGGCAGCGCAGCAGCAGGAGCCACCAGGGCGTGCGGTCGGGCGTCCGTTCGGCGTCCTCGCGCCCCAGCAGCAGGCGCACGCCAGGGAATCCGACCCGCCGCCGGCTCGGCCGCGTCNCCCGCNCCCGCCCCCCGAGCACCCGNAGCCNCNCCACCGCCGCCC
+
1>AAADAAFFF1G11AA0000AAFE/AAE0FBAEGGG#B/>EF/EGHHHHHHG?C##???/FE/ECHCE?C<FGGGGCCCGGGG@?AE.BFFEAB-9@@@FFFFFEEEEFBFF--99A-;@B=@A@@?@@>-@@--/B--@--@@-F----;@--:F---9-AB9=-@-9E-99A-;:BF-9-@@-;@-@#############################################################
@MISEQ-LAB244-W7:91:000000000-A5C7L:1:1101:15782:2187 2:N:0:TCGAAG
CAACCGGCTGATCCTCGACGCCATCGAGGCGACCGGCGCCGGCGCCGACGGGCTGATCACCGCCGCCGAGGTCGTCGCGATCAACGCGGCGATCCGCGGCGACGCGACGCCCCTCGCCGACTTCGTCGACCTGCACGGCGACGACGAGGAGGGCCTCGAGACCGGCTTCCCCCTGATCCAGGGCGACGGCGCCGCGACGCAGCTCGGCGGGTTCCACCCTCCTCACCGGGCCGCCGCCGGCTTCTACCCGA
+
BBBBBBBBDBFFGGFFEEGEFG2FHGFEGCA?EEGCE@EFEEE/EEE@EDCFDCAC2G2CG?CC/CFG?C?DHFCGCGFD-C.0;DFA-AD;AFFFF;DF-BB--@;>9D-@DAD->>=-@-9FFBDCFFFFB?.FE@---;@9@--9@9AD;D?.F.9..AE;C;-;;B.;D##############################################################################
@MISEQ-LAB244-W7:91:000000000-A5C7L:1:1101:11745:2196 2:N:0:NCGAAG
CGAAAAGCCGCGCGCCGACCTGGGCGTCGAGCGCCGCGCCGCTCCAACGAACGCCAGGCGATCCGAGCGCGGCGGCGATGGCACCCGGATCGAGCCCGGTAAAGTCGGCCCGTAGGTCGAGGCCGCCGCCGCCAGGCGCCACTTCGAGCCGTGGGAGATGCAACGTTAGCGGCGCCGCCCCGTCGGCCGTCTCGAGCAAAATGCGCGTGTCGGTGAGCCGCCGGTGCTCCGGCAACCGCATCCTGCGCCAG

$ tail JC1A_R2.fastq

+SRR098026.247 HWUSI-EAS1599_1:2:1:2:1311 length=35
#!##!#################!!!!!!!######
@SRR098026.248 HWUSI-EAS1599_1:2:1:2:118 length=35
GNTGNGGTCATCATACGCGCCCNNNNNNNGGCATG
+SRR098026.248 HWUSI-EAS1599_1:2:1:2:118 length=35
B!;?!A=5922:##########!!!!!!!######
@SRR098026.249 HWUSI-EAS1599_1:2:1:2:1057 length=35
CNCTNTATGCGTACGGCAGTGANNNNNNNGGAGAT
+SRR098026.249 HWUSI-EAS1599_1:2:1:2:1057 length=35
A!@B!BBB@ABAB#########!!!!!!!######

The -n option to either of these commands can be used to print the first or last n lines of a file.

$ head -n 1 JC1A_R2.fastq

@MISEQ-LAB244-W7:91:000000000-A5C7L:1:1101:13417:1998 2:N:0:TCGNAG

$ tail -n 1 JC1A_R2.fastq

AAA#>>A#1>AAGGGGGGGG#ABFEFGGHGEFGEGGGEGFHHHGGGGGGGGEEEEEGCG?EGHHHG@CC#??#???FFG############################################################################################################################################################################

Details on the FASTQ format

Since we are learning while using FASTQ files, let’s understand what they are. Although it looks complicated (and it is), it’s easy to understand the fastq format with a little decoding. Some rules about the format include…

Line Description

1 Always begins with ‘@’ and then information about the read

2 The actual DNA sequence

3 Always begins with a ‘+’ and sometimes the same info in line 1

4 Has a string of characters which represent the quality scores; must have same number of characters as line 2

We can view the first complete read in one of the files our dataset by using head to look at the first four lines.
$ head -n 4 JC1A_R2.fastq
@MISEQ-LAB244-W7:91:000000000-A5C7L:1:1101:13417:1998 2:N:0:TCGNAG
CGCGATCAGCAGCGGCCCGGAACCGGTCAGCCGCGCCNTGGGGTTCAGCACCGGCNNGGCGAAGGCCGCGATCGCGGCGGCGGCGATCAGGCAGCGCAGCAGCAGGAGCCACCAGGGCGTGCGGTCGGGCGTCCGTTCGGCGTCCTCGCGCCCCAGCAGCAGGCGCACGCCAGGGAATCCGACCCGCCGCCGGCTCGGCCGCGTCNCCCGCNCCCGCCCCCCGAGCACCCGNAGCCNCNCCACCGCCGCCC
+
1>AAADAAFFF1G11AA0000AAFE/AAE0FBAEGGG#B/>EF/EGHHHHHHG?C##???/FE/ECHCE?C<FGGGGCCCGGGG@?AE.BFFEAB-9@@@FFFFFEEEEFBFF--99A-;@B=@A@@?@@>-@@--/B--@--@@-F----;@--:F---9-AB9=-@-9E-99A-;:BF-9-@@-;@-@#############################################################
Most of the nucleotides are correct, although we have some unknown bases (N). This is actually a good read!

Line 4 shows the quality for each nucleotide in the read. Quality is interpreted as the probability of an incorrect base call (e.g. 1 in 10) or, equivalently, the base call accuracy (e.g. 90%). To make it possible to line up each individual nucleotide with its quality score, the numerical score is converted into a code where each individual character represents the numerical quality score for an individual nucleotide. For example, in the line above, the quality score line is:
!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!
The # character and each of the ! characters represent the encoded quality for an individual nucleotide. The numerical value assigned to each of these characters depends on the sequencing platform that generated the reads. The sequencing machine used to generate our data uses the standard Sanger quality PHRED score encoding, Illumina version 1.8 onwards. Each character is assigned a quality score between 0 and 42 as shown in the chart below.
Quality encoding: !"#$%&'()\*+,-./0123456789:;<=>?@ABCDEFGHIJK
                  |         |         |         |         |
Quality score:    0........10........20........30........40..                          
Each quality score represents the probability that the corresponding nucleotide call is incorrect. This quality score is logarithmically based, so a quality score of 10 reflects a base call accuracy of 90%, but a quality score of 20 reflects a base call accuracy of 99%. These probability values are the results from the base calling algorithm and dependent on how much signal was captured for the base incorporation.

Looking back at our read:
@MISEQ-LAB244-W7:91:000000000-A5C7L:1:1101:13417:1998 2:N:0:TCGNAG
CGCGATCAGCAGCGGCCCGGAACCGGTCAGCCGCGCCNT
+
1>AAADAAFFF1G11AA0000AAFE/AAE0FBAEGGG#B
We can now see that the quality of each of the Ns is 0 and the quality of the only nucleotide call (C) is also very poor (# = a quality score of 2). This is indeed a very bad read.

Line	Description
1	Always begins with ‘@’ and then information about the read
2	The actual DNA sequence
3	Always begins with a ‘+’ and sometimes the same info in line 1
4	Has a string of characters which represent the quality scores; must have same number of characters as line 2

Creating, moving, copying, and removing

Now we can move around in the file structure, look at files, and search files. But what if we want to copy files or move them around or get rid of them? Most of the time, you can do these sorts of file manipulations without the command line, but there will be some cases (like when you’re working with a remote computer like we are for this lesson) where it will be impossible. You’ll also find that you may be working with hundreds of files and want to do similar manipulations to all of those files. In cases like this, it’s much faster to do these operations at the command line.

Copying Files

When working with computational data, it’s important to keep a safe copy of that data that can’t be accidentally overwritten or deleted. For this lesson, our raw data is our FASTQ files. We don’t want to accidentally change the original files, so we’ll make a copy of them and change the file permissions so that we can read from, but not write to, the files.

First, let’s make a copy of one of our FASTQ files using the cp command.

Navigate to the /home/dcuser/dc_workshop/data/untrimmed_fastq directory and enter:

$ cp JC1A_R2.fastq JC1A_R2-copy.fastq
$ ls -F

JC1A_R1.fastq  JC1A_R2-copy.fastq  JC1A_R2.fastq  JP4D_R1.fastq  JP4D_R2.fastq  TruSeq3-PE.fa

We now have two copies of the JC1A_R2.fastq file, one of them named JC1A_R2-copy.fastq. We’ll move this file to a new directory called backup where we’ll store our backup data files.

Creating Directories

The mkdir command is used to make a directory. Enter mkdir followed by a space, then the directory name you want to create.

$ mkdir backup

Moving / Renaming

We can now move our backup file to this directory. We can move files around using the command mv.

$ mv JC1A_R2-copy.fastq backup
$ ls backup

JC1A_R2-copy.fastq

The mv command is also how you rename files. Let’s rename this file to make it clear that this is a backup.

$ cd backup
$ mv JC1A_R2-copy.fastq JC1A_R2-backup.fastq
$ ls

JC1A_R2-backup.fastq

Removing

When we want to remove a file or a directory we use the rm command. By default, rmwill not delete directories. You can tell rm to delete a directory using the -r (recursive) option.

Let’s delete the backup directory we just made.

$ cd ..
$ rm -r backup

This will delete not only the directory, but all files within the directory. If you have write-protected files in the directory, you will be asked whether you want to override your permission settings.

If we want to modifiy a file without all the permissions you’ll be asked if you want to override your file permissions. for example:

rm: remove write-protected regular file ‘example.fastq’?

If you enter n (for no), the file will not be deleted. If you enter y, you will delete the file. This gives us an extra measure of security, as there is one more step between us and deleting our data files.

Important: The rm command permanently removes the file. Be careful with this command. It doesn’t just nicely put the files in the Trash. They’re really gone.

Exercise 1: Make backup folder with write-protected permissions

Starting in the /home/dcuser/dc_workshop/data/untrimmed_fastq directory, do the following:

Make sure that you have deleted your backup directory and all files it contains.

Create a copy of each of your FASTQ files. (Note: You’ll need to do this individually for each of the two FASTQ files. We haven’t learned yet how to do this with a wildcard.)

Use a wildcard to move all of your backup files to a new backup directory.

Change the permissions on all of your backup files to be write-protected.
Solution

rm -r backup

cp JC1A_R1.fastq JC1A_R1-backup.fastq, cp JC1A_R2.fastq JC1A_R2-backup.fastq, cp JP4D_R1.fastq JP4D_R1-backup.fastq
and cp JP4D_R2.fastq JP4D_R2-backup.fastq

mkdir backup and mv *-backup.fastq backup

chmod -w backup/*-backup.fastq
It’s always a good idea to check your work with ls -l backup. You should see something like:
-r--r--r-- 1 dcuser dcuser  24203913 Jun 17 23:08 JC1A_R1-backup.fastq
-r--r--r-- 1 dcuser dcuser  24917444 Jun 17 23:10 JC1A_R2-backup.fastq
-r--r--r-- 1 dcuser dcuser 186962503 Jun 17 23:10 JP4D_R1-backup.fastq
-r--r--r-- 1 dcuser dcuser 212161034 Jun 17 23:10 JP4D_R2-backup.fastq

Key Points

You can view file contents using less, cat, head or tail.

The commands cp, mv, and mkdir are useful for manipulating existing files and creating new directories.

You can view file permissions using ls -l and change permissions using chmod.

The history command and the up arrow on your keyboard can be used to repeat recently used commands.

previous episode

Introduction to the Command Line for Metagenomics

next episode

Working with Files and Directories

Overview